A November Scientific Reports study claims to have detected bird flu virus RNA in flies—(house flies (Musca domestica) and blow flies (Calliphoridae)—using PCR testing.
This gives the average reader the impression that a physical bird flu virus was discovered in flies.
But the study does not claim to have found the virus itself.
It explicitly admits that “infectious virus was not detected in this study.”
It merely claims to have “detected” viral RNA.
But it doesn’t even claim to have found physical viral RNA.
It merely claims that PCR showed a positive result when applied to a sample of crushed (homogenized) flies.
The study reads:
“Furthermore, because HPAI H5N1 RNA was detected from homogenized pools of flies, the precise location of the virus—whether on the external surface and/or within the alimentary canal—remains to be determined.”
Follow us on Instagram @realjonfleetwood & Twitter/X @JonMFleetwood.
If you value this reporting, consider upgrading to a paid subscription.
For advertising & sponsorship opportunities reaching 300,000+ monthly viewers, contact us by clicking below.
PCR is said to give positive results when the sample contains genetic sequences (bits of genetic code) that match the PCR primers and probe.
The PCR sequences the test is looking for are given in the study:
“H5N1 RNA was detected by the 7500 Fast PCR Detection System (Applied Biosystems, Thermo Fisher Scientific, Inc. Waltham, MA, USA) with the AgPath ID RT-PCR kit (Applied Biosystems, Thermo Fisher Scientific, Inc. Waltham, MA, USA) which targets the Matrix gene using the following primers F25 forward: 5’ AGATGAGTCTTCTAACCGAGGTCG 3’, R124 reverse: 5’TGCAAAAACATCTTCAAGTCTCTG3’, R124-modified reverse primer: 5’TGCAAAGACACTTTCCAGTCTCTG3’, and F64 probe: FAM TCAGGCCCCCTCAAAGCCGA-BHQ-1.”
So if the above sequences of the PCR primers and probe match any of the sequences in the fly mash, you can get a positive result.
But could the test be detecting the flies’ own genetics?
To test this, I ran a genetic alignment comparing the PCR sequences to the house fly genome itself, using the government’s BLAST genetic alignment tool.
The alignment showed that the forward primer contains multiple perfect-match sequences to Musca domestica RNA.
That means the PCR could generate a “positive” signal by amplifying fly genetic material itself—without requiring the presence of any intact bird flu virus or even any viral RNA.
In other words, the PCR test could be showing positive results because the primers and probe match fly genetic material, not viral genetic material.
I also ran the forward primer against the Calliphoridae genome in BLAST.
The alignment shows that the PCR forward primer used in the study has multiple perfect or near-perfect matches to the genomes and transcripts of blow flies, meaning the PCR signal reported as “H5N1 RNA” could plausibly originate from fly genetic material itself rather than from any bird flu virus.
It’s important to understand that PCR tests, including the one used in the study, do not actually “see” viruses.
They only look for specific, short genetic patterns.
If those patterns exist in the fly’s own genetics, the test can register a positive result even when no bird flu virus or viral genetic sequences are present.
Because the researchers tested mashed-up whole flies—containing large amounts of fly genetic material—the PCR signal they report could come from the flies themselves rather than from any bird flu virus.
This could explain why the study reported PCR positives while simultaneously admitting that no physically infectious virus was ever found.
But it raises bigger questions about how PCR “positives” are used to declare outbreaks, track spread, and justify public health responses.
If a PCR signal can come from non-viral genetic material in the tested sample, then counting those results as evidence of viral presence—let alone infection—becomes scientifically questionable.
If outbreaks and pandemics are declared because of high case numbers, and case numbers are determined by positive PCR tests, and PCR tests can give positive results because they’re binding to host genetics and not viral genetics, then outbreaks and pandemics can be declared based on test results that do not actually demonstrate the presence of a virus at all.
Follow us on Instagram @realjonfleetwood & Twitter/X @JonMFleetwood.
If you value this reporting, consider upgrading to a paid subscription.
For advertising & sponsorship opportunities reaching 300,000+ monthly viewers, contact us by clicking below.











President Magufuli [of Tanzania] says [PCR] tests were found to be faulty after goat, sheep and pawpaw samples test positive for COVID-19.
The president died not long after showing the Emperor had no clothes.
No one seems to be willing to accept Nobel Laureate Kary Mullis when he said that PCR is not meant for diagnosis. You can find anything if you increase the number of cycles high enough as they did in the early months of Covid.
It was very funny. When Biden took office the WHO announced that maybe there were too many false positives and maybe they should reduce the number of cycles.
My contention is they want to get rid of doctors and replace them with cloud connected nanobots in your body that will diagnose with PCR tests and prescribe and treat you according to standard protocols. Just like protocols that were rolled out for Covid to murderous effect in hospitals and "nursing" homes. Half of the USA mortality during Covid was in nursing homes due to improper opioid medications. 90% of the patients intubated in hospitals died. It was an inappropriate treatment. True covid patients could physically breathe but were oxygen starved. Doctors and nurses who objected were sanctioned, even lost licenses.
Old McDonald had a positive PCR test E-I-E-I-O.