Hantavirus PCR Test Sequences Repeatedly Match Human DNA: New BLAST Analysis Raises False Positive Concerns
Do hantavirus PCR tests mistake human DNA for a virus?
A BLAST analysis of the forward primer, reverse primer, and fluorescent probe used in a published hantavirus RT-qPCR assay revealed repeated exact matches to human genomic material, raising questions about whether human nucleic acids could plausibly contribute to positive hantavirus PCR signal generation under some assay conditions.
BLAST stands for Basic Local Alignment Search Tool, a widely used bioinformatics algorithm for comparing biological sequences.
In plain English, portions of the genetic sequences used by the PCR test to supposedly detect hantavirus also directly match human DNA sequences.
That means the test components were not exclusively unique to hantavirus at the sequence level.
Positive results could indicate the presence of human material, not viral.
The revelation comes as the mainstream media is raising alarm over an alleged hantavirus outbreak on a cruise ship off West Africa.
The new BLAST findings become more significant when viewed alongside the original U.S. Patent 5,210,015, which explicitly states that PCR probe complementarity “need not be perfect” and that a detectable signal can occur through “polymerization-independent cleavage,” meaning detectable fluorescent signal generation does not necessarily require full target amplification.
In simpler terms, the original patent behind modern TaqMan PCR testing acknowledges that the chemistry can still generate a detectable signal even when the genetic matching is imperfect and even when full amplification of the target sequence is not occurring.
Even partial similarity between hantavirus PCR components and human genetics could result in a positive test result, even when no virus is present.
Follow us on Instagram @realjonfleetwood & Twitter/X @JonMFleetwood.
If you value this reporting, consider upgrading to a paid subscription.
For advertising & sponsorship opportunities, contact us by clicking below.
PCR Test’s Primers and Probe
The assay components analyzed included:
Forward primer:
GCAGCTGTGTCTACATTGGAGAAReverse primer:
TGGTTTTGAAGCCAGTTTTTGAProbe sequence:
AAACTCGCAGAACTCAAGAGACAGCTGGC
They were acquired from a December 2019 PLoS Neglected Tropical Diseases study.
Primers are short genetic sequences designed to bind to a target region so amplification can begin.
The probe is the fluorescent detection component that helps generate the “positive” signal seen by the machine.
The probe sequence was derived from the published assay after removing the fluorescent reporter and quencher chemistry labels (FAM and ZEN) so that only the nucleotide sequence itself was analyzed.
Forward Primer Produced Extensive Human Matches
The forward primer BLAST analysis produced numerous exact and near-exact matches to human genomic material.
That means portions of the primer sequence directly matched sequences already naturally present inside the human genome.
The results included:
repeated 19/19 exact matches,
multiple 18/18 exact matches,
repeated 17/17 exact matches,
and widespread 16/16 matches.
A “19/19 exact match” means 19 consecutive genetic letters matched perfectly between the queried sequence and human DNA.
The sequence aligned with:
GALNT6-associated regions,
EPHB2-associated regions,
ZBTB20-associated regions,
chromosome 1,
chromosome 3,
enhancer regions,
BAC clone libraries,
and numerous additional human genomic loci.
One alignment showed:
“Identities:19/19(100%)”
Another showed:
“Identities:18/18(100%)”
Reverse Primer Also Matched Human DNA Across Multiple Chromosomes
The reverse primer produced similarly extensive human alignments.
In other words, both sides of the PCR amplification system showed substantial sequence overlap with human genetic material.
The results included:
repeated 20/20 exact matches,
multiple 18/18 exact matches,
numerous 17/17 exact matches,
and widespread 16/16 exact matches.
A “20/20 exact match” means all 20 genetic letters aligned perfectly with human DNA.
The sequence aligned with:
RBFOX1,
KCNH5,
TGFB2,
DLG2,
CDH13,
ROBO2,
PLA2G4A,
MYO5C,
immunoglobulin heavy chain regions,
and numerous human chromosomal regions including chromosomes 1, 3, 5, 8, 11, 14, 15, 16, 18, 20, 21, X, and Y.
One alignment showed:
“Identities:20/20(100%)”
Others showed:
“Identities:18/18(100%)”
and:
“Identities:17/17(100%)”
Fluorescent Detection Probe Produced Repeated Exact Human Matches
The strongest findings came from the BLAST analysis of the TaqMan fluorescent probe itself—the sequence directly involved in signal detection chemistry.
This is important because the probe is the part responsible for generating the fluorescent signal that the PCR machine interprets as a “positive.”
The probe produced:
repeated 18/18 exact matches,
numerous 17/17 exact matches,
repeated 16/16 exact matches,
and a 20/21 (95%) alignment to human genomic DNA.
A 20/21 match means 20 out of 21 genetic letters aligned with human DNA.
The probe aligned with:
chromosome 1,
chromosome 12,
chromosome 18,
chromosome 19,
chromosome 21,
TMEM192,
MGA transcript variants,
BCLAF3,
SESN1,
OCT4-NANOG enhancer regions,
and multiple BAC and FOSMID human genomic libraries.
One alignment showed:
“Identities:18/18(100%)”
Another showed:
“Identities:17/17(100%)”
And another showed:
“Identities:20/21(95%)”
Original TaqMan Patent Acknowledges Imperfect Complementarity
The original TaqMan PCR patent explicitly states:
“Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases.”
The patent acknowledges that the positive result-producing chemistry can still function even when the genetic match is imperfect.
The patent further states:
“In this process, polymerization is not required to bring the nucleic acid polymerase into position to accomplish the cleavage, therefore we call this polymerization-independent cleavage.”
That means the detectable signal chemistry can occur even without full amplification of the target sequence.
And:
“Thus, a sufficient amount of labeled fragments can be generated, making detection possible in the absence of polymerization.”
Meaning the patent explicitly describes situations where detectable signal can occur even without the full amplification process people commonly associate with PCR.
The patent also explains:
“One advantage of the polymerization-independent process lies in the elimination of the need for amplification of the target sequence.”
Detectable signal generation can occur without needing the full target genetic sequence to be completely amplified first.
Bottom Line
The BLAST findings and patent language show:
the forward primer shares repeated exact matches with human DNA,
the reverse primer shares repeated exact matches with human DNA,
and the fluorescent detection probe itself shares repeated exact matches with human DNA.
All three major components involved in the assay’s amplification and detection system showed direct sequence overlap with human genetic material.
Meanwhile, the original TaqMan patent explicitly acknowledges that:
complementarity “need not be perfect,”
detectable signal can occur through “polymerization-independent cleavage,”
and detection can occur “in the absence of polymerization.”
Combined, the findings raise the possibility that human genetic material itself could plausibly contribute to positive hantavirus PCR signal generation under some assay conditions.
If the assay’s primers and fluorescent detection probe substantially overlap with human genetic material, then so-called hantavirus “cases” may represent nothing more than the PCR system detecting the patient’s own genetics rather than an actual virus.
Follow us on Instagram @realjonfleetwood & Twitter/X @JonMFleetwood.
If you value this reporting, consider upgrading to a paid subscription.
For advertising & sponsorship opportunities, contact us by clicking below.
Jon, I ran a quick BLASTP and it shows protein sequence homology between C. tetani proteins and Hantavirus. Anyone who received a tetanus shot is making inappropriate IgE antibodies against C.tetani proteins that contaminate the shot. Due to cross reaction, upon hantavirus infection, they will suffer severe disease due to their bodies mounting an inappropriate allergic/anti-parasite immune response to hantavirus. Thus hantavirus disease severity is most likely iatrogenic.
https://www.uniprot.org/blast/uniprotkb/ncbiblast-R20260505-190139-0032-66034192-p1m/overview
Query= tr|A0A509GTB2|A0A509GTB2_9VIRU RNA-directed RNA polymerase L
(Fragment) OS=Hantavirus HantaV-1 OX=2559107 PE=4 SV=1
>TR:Q896G5 Q896G5_CLOTE Stage V sporulation protein R OS=Clostridium tetani
(strain Massachusetts / E88) OX=212717 GN=CTC_01041 PE=4
SV=1
Length=417
Score = 22.3 bits (46), Expect = 9.2
Identities = 9/18 (50%), Positives = 12/18 (67%), Gaps = 0/18 (0%)
Query 18 GLKDDLLKNCVIDALRNI 35
G+KD L NC I+ + NI
Sbjct 336 GMKDTLYLNCGINTIPNI 353
Basic Local Alignment Search Tool (BLAST) can find short sequence similarities between primers and unrelated genomes. That part is true. But your leap (wherever you copied this schlock from) being is flawed:
Short matches are common and expected because PCR primers are short (~18–25 bases).
At that length random matches to human DNA happen frequently. This doen't mean the test will amplify human DNA in practice.
What matters is full primer pair binding, correct orientation, correct distance and reaction conditions.
PCR assays are validated against human samples. Clinical RT-qPCR assays are tested extensively to ensure:
No amplification from human genomic DNA
No cross-reactivity with other organisms
High specificity under real conditions
If a test routinely amplified human DNA, it would fail validation immediately.
The patent argument is being misused
US5210015 does say probes don’t require perfect complementarity but the chemistry still requires specific hybridization under controlled conditions
“Polymerization-independent cleavage” refers to edge-case probe behavior, not routine signal generation from random human DNA. In real assays, signal thresholds, controls, and cycle limits prevent spurious detection
“Partial similarity = positive test” is INCORRECT. Partial or incidental similarity alone does not produce a clinically reported positive. A valid positive RT-qPCR signal requires:
Both primers binding correctly
Amplification across cycles
Probe binding and cleavage
Signal crossing a defined threshold (Ct value)
And so on ....